Source code for cnvlib.export

"""Export CNVkit objects and files to other formats."""

from __future__ import annotations
import logging
import time
from collections import OrderedDict as OD
from typing import TYPE_CHECKING, Optional, Union

import numpy as np
import pandas as pd
from skgenome import tabio

from . import call
from .cmdutil import read_cna
from ._version import __version__

if TYPE_CHECKING:
    from collections.abc import Iterator
    from cnvlib.cnary import CopyNumArray
    from cnvlib.vary import VariantArray
    from numpy import ndarray


[docs] def merge_samples(filenames: list[str]) -> pd.DataFrame: """Merge probe values from multiple samples into a 2D table (of sorts). Input: dict of {sample ID: (probes, values)} Output: list-of-tuples: (probe, log2 coverages...) """ def row2label(row) -> str: return f"{row.chromosome}:{row.start}-{row.end}:{row.gene}" def label_with_gene(cnarr): return cnarr.data.apply(row2label, axis=1) if not filenames: return [] first_cnarr = read_cna(filenames[0]) out_table = first_cnarr.data.reindex(columns=["chromosome", "start", "end", "gene"]) out_table["label"] = label_with_gene(first_cnarr) out_table[first_cnarr.sample_id] = first_cnarr["log2"] for fname in filenames[1:]: cnarr = read_cna(fname) if not ( len(cnarr) == len(out_table) and (label_with_gene(cnarr) == out_table["label"]).all() ): raise ValueError(f"Mismatched row coordinates in {fname}") # Copy the next column by sample ID if cnarr.sample_id in out_table.columns: raise ValueError(f"Duplicate sample ID: {cnarr.sample_id}") out_table[cnarr.sample_id] = cnarr["log2"] del cnarr return out_table
# Supported formats:
[docs] def fmt_cdt(sample_ids, table): """Format as CDT. See: - http://jtreeview.sourceforge.net/docs/JTVUserManual/ch02s11.html - http://www.eisenlab.org/FuzzyK/cdt.html """ outheader = ["GID", "CLID", "NAME", "GWEIGHT", *sample_ids] header2 = ["AID", "", "", ""] header2.extend(["ARRY" + str(i).zfill(3) + "X" for i in range(len(sample_ids))]) header3 = ["EWEIGHT", "", "", ""] + ["1"] * len(sample_ids) outrows = [header2, header3] outtable = pd.concat( [ pd.DataFrame.from_dict( OD( [ ("GID", pd.Series(table.index).apply(lambda x: f"GENE{x}X")), ( "CLID", pd.Series(table.index).apply(lambda x: f"IMAGE:{x}"), ), ("NAME", table["label"]), ("GWEIGHT", 1), ] ) ), table.drop(["chromosome", "start", "end", "gene", "label"], axis=1), ], axis=1, ) outrows.extend(outtable.itertuples(index=False)) return outheader, outrows
# TODO
[docs] def fmt_gct(sample_ids, table): return NotImplemented
[docs] def fmt_jtv(sample_ids: list[str], table: pd.DataFrame) -> tuple[list[str], map]: """Format for Java TreeView.""" outheader = ["CloneID", "Name", *sample_ids] outtable = pd.concat( [ pd.DataFrame( { "CloneID": "IMAGE:", "Name": table["label"], } ), table.drop(["chromosome", "start", "end", "gene", "label"], axis=1), ], axis=1, ) outrows = outtable.itertuples(index=False) return outheader, outrows
# Special cases
[docs] def export_nexus_basic(cnarr: CopyNumArray) -> pd.DataFrame: """Biodiscovery Nexus Copy Number "basic" format. Only represents one sample per file. """ out_table = cnarr.data.reindex( columns=["chromosome", "start", "end", "gene", "log2"] ) out_table["probe"] = cnarr.labels() return out_table
[docs] def export_nexus_ogt( cnarr: CopyNumArray, varr: VariantArray, min_weight: float = 0.0 ) -> pd.DataFrame: """Biodiscovery Nexus Copy Number "Custom-OGT" format. To create the b-allele frequencies column, alterate allele frequencies from the VCF are aligned to the .cnr file bins. Bins that contain no variants are left blank; if a bin contains multiple variants, then the frequencies are all "mirrored" to be above or below .5 (majority rules), then the median of those values is taken. """ if min_weight and "weight" in cnarr: mask_low_weight = cnarr["weight"] < min_weight logging.info( "Dropping %d bins with weight below %f", mask_low_weight.sum(), min_weight ) cnarr.data = cnarr.data[~mask_low_weight] bafs = varr.baf_by_ranges(cnarr) logging.info("Placed %d variants into %d bins", sum(~np.isnan(bafs)), len(cnarr)) out_table = cnarr.data.reindex(columns=["chromosome", "start", "end", "log2"]) out_table = out_table.rename( columns={ "chromosome": "Chromosome", "start": "Position", "end": "Position", "log2": "Log R Ratio", } ) out_table["B-Allele Frequency"] = bafs return out_table
[docs] def export_seg(sample_fnames: list[str], chrom_ids: bool = False) -> pd.DataFrame: """SEG format for copy number segments. Segment breakpoints are not the same across samples, so samples are listed in serial with the sample ID as the left column. """ dframes, sample_ids = zip(*(_load_seg_dframe_id(fname) for fname in sample_fnames), strict=False) out_table = tabio.seg.write_seg(dframes, sample_ids, chrom_ids) return out_table
def _load_seg_dframe_id(fname: str) -> tuple[pd.DataFrame, str]: segarr = read_cna(fname) assert segarr is not None assert segarr.data is not None assert segarr.sample_id is not None return segarr.data, segarr.sample_id # _____________________________________________________________________________ # BED
[docs] def export_bed( segments: CopyNumArray, ploidy: int, is_haploid_x_reference: bool, diploid_parx_genome: Optional[str], is_sample_female: bool, label: str, show: str, ) -> pd.DataFrame: """Convert a copy number array to a BED-like DataFrame. For each region in each sample (possibly filtered according to `show`), the columns are: - reference sequence name - start (0-indexed) - end - sample name or given label - integer copy number By default (show="ploidy"), skip regions where copy number is the default ploidy, i.e. equal to 2 or the value set by --ploidy. If show="variant", skip regions where copy number is neutral, i.e. equal to the reference ploidy on autosomes, or half that on sex chromosomes. """ out = segments.data.reindex(columns=["chromosome", "start", "end"]) out["label"] = label if label else segments["gene"] out["ncopies"] = ( segments["cn"] if "cn" in segments else call.absolute_pure(segments, ploidy, is_haploid_x_reference) .round() .astype("int") ) if show == "ploidy": # Skip regions of default ploidy out = out[out["ncopies"] != ploidy] elif show == "variant": # Skip regions of non-neutral copy number exp_copies = call.absolute_expect( segments, ploidy, diploid_parx_genome, is_sample_female ) out = out[out["ncopies"] != exp_copies] return out
# _____________________________________________________________________________ # VCF VCF_HEADER = """\ ##fileformat=VCFv4.2 ##fileDate={date} ##source=CNVkit v{version} ##INFO=<ID=CIEND,Number=2,Type=Integer,Description="Confidence interval around END for imprecise variants"> ##INFO=<ID=CIPOS,Number=2,Type=Integer,Description="Confidence interval around POS for imprecise variants"> ##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record"> ##INFO=<ID=IMPRECISE,Number=0,Type=Flag,Description="Imprecise structural variation"> ##INFO=<ID=SVLEN,Number=1,Type=Integer,Description="Difference in length between REF and ALT alleles"> ##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant"> ##INFO=<ID=FOLD_CHANGE,Number=1,Type=Float,Description="Fold change"> ##INFO=<ID=FOLD_CHANGE_LOG,Number=1,Type=Float,Description="Log fold change"> ##INFO=<ID=PROBES,Number=1,Type=Integer,Description="Number of probes in CNV"> ##ALT=<ID=DEL,Description="Deletion"> ##ALT=<ID=DUP,Description="Duplication"> ##ALT=<ID=CNV,Description="Copy number variable region"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype quality"> ##FORMAT=<ID=CN,Number=1,Type=Integer,Description="Copy number genotype for imprecise events"> ##FORMAT=<ID=CNQ,Number=1,Type=Float,Description="Copy number genotype quality for imprecise events"> """.format(date=time.strftime("%Y%m%d"), version=__version__) # #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 # 1 2827693 . CCGTGGATGCGGGGACCCGCATCCCCTCTCCCTTCACAGCTGAGTGACCCACATCCCCTCTCCCCTCGCA C . PASS SVTYPE=DEL;END=2827680;BKPTID=Pindel_LCS_D1099159;HOMLEN=1;HOMSEQ=C;SVLEN=-66 GT:GQ 1/1:13.9 # 2 321682 . T <DEL> 6 PASS IMPRECISE;SVTYPE=DEL;END=321887;SVLEN=-105;CIPOS=-56,20;CIEND=-10,62 GT:GQ 0/1:12 # 3 12665100 . A <DUP> 14 PASS IMPRECISE;SVTYPE=DUP;END=12686200;SVLEN=21100;CIPOS=-500,500;CIEND=-500,500 GT:GQ:CN:CNQ ./.:0:3:16.2 # 4 18665128 . T <DUP:TANDEM> 11 PASS IMPRECISE;SVTYPE=DUP;END=18665204;SVLEN=76;CIPOS=-10,10;CIEND=-10,10 GT:GQ:CN:CNQ ./.:0:5:8.3
[docs] def export_vcf( segments: CopyNumArray, ploidy: int, is_haploid_x_reference: bool, diploid_parx_genome: Optional[str], is_sample_female: bool, sample_id: None = None, cnarr: None = None, ) -> tuple[str, str]: """Convert segments to Variant Call Format. For now, only 1 sample per VCF. (Overlapping CNVs seem tricky.) Spec: https://samtools.github.io/hts-specs/VCFv4.2.pdf """ vcf_columns = [ "#CHROM", "POS", "ID", "REF", "ALT", "QUAL", "FILTER", "INFO", "FORMAT", sample_id or segments.sample_id, ] if cnarr: segments = assign_ci_start_end(segments, cnarr) vcf_rows = segments2vcf( segments, ploidy, is_haploid_x_reference, diploid_parx_genome, is_sample_female ) table = pd.DataFrame.from_records(vcf_rows, columns=vcf_columns) vcf_body = table.to_csv(sep="\t", header=True, index=False, float_format="%.3g") return VCF_HEADER, vcf_body
[docs] def assign_ci_start_end(segarr, cnarr): """Assign ci_start and ci_end fields to segments. Values for each segment indicate the CI boundary points within that segment, i.e. the right CI boundary for the left-side breakpoint (segment start), and left CI boundary for the right-side breakpoint (segment end). This is a little unintuitive because the CI refers to the breakpoint, not the segment, but we're storing the info in an array of segments. Calculation: Just use the boundaries of the bins left- and right-adjacent to each segment breakpoint. """ lefts_rights = ( (bins.end.iat[0], bins.start.iat[-1]) if len(bins.end) > 0 and len(bins.start) > 0 else (np.nan, np.nan) for _seg, bins in cnarr.by_ranges(segarr, mode="outer") ) ci_lefts, ci_rights = zip(*lefts_rights, strict=False) return segarr.as_dataframe(segarr.data.assign(ci_left=ci_lefts, ci_right=ci_rights))
[docs] def segments2vcf( segments: CopyNumArray, ploidy: int, is_haploid_x_reference: bool, diploid_parx_genome: Optional[str], is_sample_female: bool, ) -> Iterator[tuple[str, int, str, str, str, str, str, str, str, str]]: """Convert copy number segments to VCF records.""" out_dframe = segments.data.reindex(columns=["chromosome", "end", "log2", "probes"]) out_dframe["start"] = segments.start.replace(0, 1) if "cn" in segments: out_dframe["ncopies"] = segments["cn"] abs_expect = call.absolute_expect( segments, ploidy, diploid_parx_genome, is_sample_female ) else: abs_dframe = call.absolute_dataframe( segments, ploidy, 1.0, is_haploid_x_reference, diploid_parx_genome, is_sample_female, ) out_dframe["ncopies"] = abs_dframe["absolute"].round().astype("int") abs_expect = abs_dframe["expect"] idx_losses = out_dframe["ncopies"] < abs_expect svlen = segments.end - segments.start svlen[idx_losses] *= -1 out_dframe["svlen"] = svlen out_dframe["svtype"] = "DUP" out_dframe.loc[idx_losses, "svtype"] = "DEL" out_dframe["format"] = "GT:GQ:CN:CNQ" out_dframe.loc[idx_losses, "format"] = "GT:GQ" # :CN:CNQ ? if "ci_left" in segments and "ci_right" in segments: has_ci = True # Calculate fuzzy left&right coords for CIPOS and CIEND left_margin = segments["ci_left"].to_numpy() - segments.start.to_numpy() right_margin = segments.end.to_numpy() - segments["ci_right"].to_numpy() out_dframe["ci_pos_left"] = np.r_[0, -right_margin[:-1]] out_dframe["ci_pos_right"] = left_margin out_dframe["ci_end_left"] = right_margin out_dframe["ci_end_right"] = np.r_[left_margin[1:], 0] else: has_ci = False # Reformat this data to create INFO and genotype # TODO be more clever about this for out_row, abs_exp in zip(out_dframe.itertuples(index=False), abs_expect, strict=False): if ( out_row.ncopies == abs_exp or # Survive files from buggy v0.7.1 (#53) not str(out_row.probes).isdigit() ): # Skip regions of neutral copy number continue # or "CNV" for subclonal? if out_row.ncopies > abs_exp: genotype = f"0/1:0:{out_row.ncopies}:{out_row.probes}" elif out_row.ncopies < abs_exp: # TODO XXX handle non-diploid ploidies, haploid chroms if out_row.ncopies == 0: # Complete deletion, 0 copies gt = "1/1" else: # Single copy deletion gt = "0/1" genotype = f"{gt}:{out_row.probes}" fields = [ "IMPRECISE", f"SVTYPE={out_row.svtype}", f"END={out_row.end}", f"SVLEN={out_row.svlen}", f"FOLD_CHANGE={2.0**out_row.log2}", f"FOLD_CHANGE_LOG={out_row.log2}", f"PROBES={out_row.probes}", ] if has_ci: fields.extend( [ f"CIPOS=({out_row.ci_pos_left},{out_row.ci_pos_right})", f"CIEND=({out_row.ci_end_left},{out_row.ci_end_right})", ] ) info = ";".join(fields) yield ( out_row.chromosome, out_row.start, ".", "N", f"<{out_row.svtype}>", ".", ".", info, out_row.format, genotype, )
# _____________________________________________________________________________ # GISTIC
[docs] def export_gistic_markers(cnr_fnames): """Generate a GISTIC 2.0 "markers" file from a set of .cnr files. GISTIC documentation: ftp://ftp.broadinstitute.org/pub/GISTIC2.0/GISTICDocumentation_standalone.htm http://genepattern.broadinstitute.org/ftp/distribution/genepattern/modules_public_server_doc/GISTIC2.pdf http://gdac.broadinstitute.org/runs/analyses__2013_05_23/reports/cancer/KICH-TP/CopyNumber_Gistic2/nozzle.html The markers file identifies the marker names and positions of the markers in the original dataset (before segmentation). It is a three column, tab-delimited file with an optional header. The column headers are: (1) Marker Name (2) Chromosome (3) Marker Position (in bases) GISTIC also needs an accompanying SEG file generated from corresponding .cns files. """ colnames = ["ID", "CHROM", "POS"] out_chunks = [] # TODO since markers will mostly be the same, # detect duplicates & exclude them # seen_marker_ids = None for fname in cnr_fnames: cna = read_cna(fname) marker_ids = cna.labels() tbl = pd.concat( [ pd.DataFrame( { "ID": marker_ids, "CHROM": cna.chromosome, "POS": cna.start + 1, }, columns=colnames, ), pd.DataFrame( { "ID": marker_ids, "CHROM": cna.chromosome, "POS": cna.end, }, columns=colnames, ), ], ignore_index=True, ) out_chunks.append(tbl) return pd.concat(out_chunks).drop_duplicates()
# _____________________________________________________________________________ # THetA
[docs] def export_theta( tumor_segs: CopyNumArray, normal_cn: Optional[CopyNumArray] ) -> pd.DataFrame: """Convert tumor segments and normal .cnr or reference .cnn to THetA input. Follows the THetA segmentation import script but avoid repeating the pileups, since we already have the mean depth of coverage in each target bin. The options for average depth of coverage and read length do not matter crucially for proper operation of THetA; increased read counts per bin simply increase the confidence of THetA's results. THetA2 input format is tabular, with columns: ID, chrm, start, end, tumorCount, normalCount where chromosome IDs ("chrm") are integers 1 through 24. """ out_columns = ["#ID", "chrm", "start", "end", "tumorCount", "normalCount"] if not tumor_segs: return pd.DataFrame(columns=out_columns) # Drop any chromosomes that are not integer or XY # THetA hard-codes X & Y, so we can, too # xy_names = (["chrX", "chrY"] # if tumor_segs.chromosome.iat[0].startswith('chr') # else ["X", "Y"]) # NB: THetA2 now apparently just drops X and Y (#153) xy_names = [] tumor_segs = tumor_segs.autosomes(also=xy_names) if normal_cn: normal_cn = normal_cn.autosomes(also=xy_names) table = tumor_segs.data.reindex(columns=["start", "end"]) # Convert chromosome names to 1-based integer indices chr2idx = {c: i + 1 for i, c in enumerate(tumor_segs.chromosome.drop_duplicates())} table["chrm"] = tumor_segs.chromosome.map(chr2idx) # Unique string identifier for each row, e.g. "start_1_93709:end_1_19208166" table["#ID"] = [ f"start_{row.chrm}_{row.start}:end_{row.chrm}_{row.end}" for row in table.itertuples(index=False) ] # Calculate/estimate per-segment read counts in tumor and normal samples ref_means, nbins = ref_means_nbins(tumor_segs, normal_cn) table["tumorCount"] = theta_read_counts(tumor_segs.log2, nbins) table["normalCount"] = theta_read_counts(ref_means, nbins) return table[out_columns]
[docs] def ref_means_nbins( tumor_segs: CopyNumArray, normal_cn: Optional[CopyNumArray] ) -> tuple[ndarray, pd.Series]: """Extract segments' reference mean log2 values and probe counts. Code paths:: wt_mdn wt_old probes norm -> norm, nbins + * * - 0, wt_mdn - + + - 0, wt_old * probes - + - - 0, wt_old * size? - - + - 0, probes - - - - 0, size? + - + + norm, probes + - - + norm, bin counts - + + + norm, probes - + - + norm, bin counts - - + + norm, probes - - - + norm, bin counts """ if normal_cn: log2s_in_segs = [bins["log2"] for _seg, bins in normal_cn.by_ranges(tumor_segs)] # For the normal/reference bin count, take the mean of the bin values # within each segment so that segments match between tumor and normal. # ENH: weighted mean, like genemetrics ref_means = np.array([s.mean() for s in log2s_in_segs]) if "probes" in tumor_segs: nbins = tumor_segs["probes"] else: nbins = np.array([len(s) for s in log2s_in_segs]) else: # Assume neutral reference log2 across all segments # (weights already account for reference log2) ref_means = np.zeros(len(tumor_segs)) if "weight" in tumor_segs and (tumor_segs["weight"] > 1.0).any(): # Segment weights are already multiplied by probe counts nbins = tumor_segs["weight"] # Rescale to average 1.0 (we'll do the same below, too) nbins /= nbins.max() / nbins.mean() else: if "probes" in tumor_segs: nbins = tumor_segs["probes"] else: logging.warning( "No probe counts in tumor segments file and no " "normal reference given; guessing normal " "read-counts-per-segment from segment sizes" ) sizes = tumor_segs.end - tumor_segs.start nbins = sizes / sizes.mean() if "weight" in tumor_segs: # Already checked -- these are old-style weights that were not # multiplied by `probes` originally nbins *= tumor_segs["weight"] / tumor_segs["weight"].mean() return ref_means, nbins
[docs] def theta_read_counts( log2_ratio: Union[pd.Series, ndarray], nbins: pd.Series, # These scaling factors don't meaningfully affect # THetA's calculation unless they're too small avg_depth: int = 500, avg_bin_width: int = 200, read_len: int = 100, ) -> pd.Series: """Calculate segments' read counts from log2-ratios. Math: nbases = read_length * read_count and nbases = bin_width * read_depth where read_depth = read_depth_ratio * avg_depth So: read_length * read_count = bin_width * read_depth read_count = bin_width * read_depth / read_length """ read_depth = (2**log2_ratio) * avg_depth read_count = nbins * avg_bin_width * read_depth / read_len return read_count.round().fillna(0).astype("int")
[docs] def export_theta_snps(varr: VariantArray) -> Iterator[pd.DataFrame]: """Generate THetA's SNP per-allele read count "formatted.txt" files.""" # Drop any chromosomes that are not integer or XY varr = varr.autosomes( also=( ["chrX", "chrY"] if varr.chromosome.iat[0].startswith("chr") else ["X", "Y"] ) ) # Skip indels varr = varr[(varr["ref"].str.len() == 1) & (varr["alt"].str.len() == 1)] # Drop rows with any NaN varr.data = varr.data.dropna(subset=["depth", "alt_count"]) if "n_depth" in varr and "n_alt_count" in varr: varr.data = varr.data.dropna(subset=["n_depth", "alt_count"]) # Avoid weird situation I've seen on alt contigs varr = varr[varr["depth"] >= varr["alt_count"]] # Reformat for THetA2 for depth_key, alt_key in (("depth", "alt_count"), ("n_depth", "n_alt_count")): # Extract the SNP allele counts that THetA2 uses table = varr.data.reindex(columns=("chromosome", "start", depth_key, alt_key)) table = ( table.assign(ref_depth=table[depth_key] - table[alt_key]) .reindex(columns=("chromosome", "start", "ref_depth", alt_key)) .dropna() ) table["ref_depth"] = table["ref_depth"].astype("int") table[alt_key] = table[alt_key].astype("int") table.columns = ["#Chrm", "Pos", "Ref_Allele", "Mut_Allele"] yield table
# _____________________________________________________________________________ EXPORT_FORMATS = { "cdt": fmt_cdt, # 'gct': fmt_gct, "gistic": export_gistic_markers, "jtv": fmt_jtv, "nexus-basic": export_nexus_basic, "nexus-ogt": export_nexus_ogt, "seg": export_seg, "theta": export_theta, "vcf": export_vcf, }