"""Export CNVkit objects and files to other formats."""
from __future__ import absolute_import, division, print_function
import collections
import logging
import time
import numpy as np
import pandas as pd
from Bio._py3k import map, range, zip
from . import call, core, params
from .cnary import CopyNumArray as CNA
from .vary import VariantArray as VA
from ._version import __version__
[docs]def merge_samples(filenames):
"""Merge probe values from multiple samples into a 2D table (of sorts).
Input:
dict of {sample ID: (probes, values)}
Output:
list-of-tuples: (probe, log2 coverages...)
"""
def label_with_gene(cnarr):
row2label = lambda row: "{}:{}-{}:{}".format(
row.chromosome, row.start, row.end, row.gene)
return cnarr.data.apply(row2label, axis=1)
if not filenames:
return []
first_cnarr = CNA.read(filenames[0])
out_table = first_cnarr.data.loc[:, ["chromosome", "start", "end", "gene"]]
out_table["label"] = label_with_gene(first_cnarr)
out_table[first_cnarr.sample_id] = first_cnarr["log2"]
for fname in filenames[1:]:
cnarr = CNA.read(fname)
# Verify labels match
labels = label_with_gene(cnarr)
if not (labels == out_table["label"]).all():
raise ValueError("Mismatched row coordinates in %s" % fname)
# Copy the next column by sample ID
if cnarr.sample_id in out_table.columns:
raise ValueError("Duplicate sample ID: %s" % cnarr.sample_id)
out_table[cnarr.sample_id] = cnarr["log2"]
del cnarr
return out_table
# Supported formats:
[docs]def fmt_cdt(sample_ids, table):
"""Format as CDT."""
outheader = ['GID', 'CLID', 'NAME', 'GWEIGHT'] + sample_ids
header2 = ['AID', '', '', '']
header2.extend(['ARRY' + str(i).zfill(3) + 'X'
for i in range(len(sample_ids))])
outrows = [header2]
outtable = pd.concat([
pd.DataFrame({
"GID": table.index.apply(lambda x: "GENE%dX" % x),
"CLID": table.index.apply(lambda x: "IMAGE:%d" % x),
"NAME": table["label"],
"GWEIGHT": 1,
}),
table.drop(["chromosome", "start", "end", "gene", "label"],
axis=1)],
axis=1)
outrows.extend(outtable.itertuples(index=False))
return outheader, outrows
# TODO
[docs]def fmt_gct(sample_ids, table):
return NotImplemented
[docs]def fmt_jtv(sample_ids, table):
"""Format for Java TreeView."""
outheader = ["CloneID", "Name"] + sample_ids
outtable = pd.concat([
pd.DataFrame({
"CloneID": "IMAGE:",
"Name": table["label"],
}),
table.drop(["chromosome", "start", "end", "gene", "label"],
axis=1)],
axis=1)
outrows = outtable.itertuples(index=False)
return outheader, outrows
# Special cases
[docs]def export_nexus_basic(sample_fname):
"""Biodiscovery Nexus Copy Number "basic" format.
Only represents one sample per file.
"""
cnarr = CNA.read(sample_fname)
out_table = cnarr.data.loc[:, ['chromosome', 'start', 'end', 'gene', 'log2']]
out_table['probe'] = cnarr.labels()
return out_table
[docs]def export_nexus_ogt(sample_fname, vcf_fname, sample_id,
min_depth=20, min_weight=0.0):
"""Biodiscovery Nexus Copy Number "Custom-OGT" format.
To create the b-allele frequencies column, alterate allele frequencies from
the VCF are aligned to the .cnr file bins. Bins that contain no variants
are left blank; if a bin contains multiple variants, then the frequencies
are all "mirrored" to be above .5, then the median of those values is taken.
"""
cnarr = CNA.read(sample_fname)
if min_weight and "weight" in cnarr:
mask_low_weight = (cnarr["weight"] < min_weight)
logging.info("Dropping %d bins with weight below %f",
mask_low_weight.sum(), min_weight)
cnarr.data = cnarr.data[~mask_low_weight]
varr = VA.read_vcf(vcf_fname, sample_id=sample_id or cnarr.sample_id,
min_depth=min_depth, skip_hom=True, skip_somatic=True)
bafs = cnarr.match_to_bins(varr, 'alt_freq', np.nan,
summary_func=mirrored_baf_median)
logging.info("Placed %d variants into %d bins",
sum(~np.isnan(bafs)), len(cnarr))
out_table = cnarr.data.loc[:, ['chromosome', 'start', 'end', 'log2']]
out_table = out_table.rename(columns={
"chromosome": "Chromosome",
"start": "Position",
"end": "Position",
"log2": "Log R Ratio",
})
out_table["B-Allele Frequency"] = bafs
return out_table
[docs]def export_seg(sample_fnames):
"""SEG format for copy number segments.
Segment breakpoints are not the same across samples, so samples are listed
in serial with the sample ID as the left column.
"""
out_tables = []
chrom_ids = None
for fname in sample_fnames:
segments = CNA.read(fname)
if chrom_ids is None:
# Create & store
chrom_ids = create_chrom_ids(segments)
else:
# Verify
core.assert_equal("Segment chromosome names differ",
previous=chrom_ids.keys(),
current=create_chrom_ids(segments).keys())
table = segments.data.loc[:, ["start", "end"]]
table["ID"] = segments.sample_id
table["mean"] = segments.data["log2"]
table["chromosome"] = [chrom_ids[chrom]
for chrom in segments["chromosome"]]
if "probes" in segments:
table["num_probes"] = segments["probes"]
sorted_cols = ["ID", "chromosome", "start", "end", "num_probes",
"mean"]
else:
sorted_cols = ["ID", "chromosome", "start", "end", "mean"]
out_tables.append(table.reindex(columns=sorted_cols))
return pd.concat(out_tables)
[docs]def create_chrom_ids(segments):
"""Map chromosome names to integers in the order encountered."""
mapping = collections.OrderedDict()
curr_idx = 1
for chrom in segments.chromosome:
if chrom not in mapping:
mapping[chrom] = curr_idx
curr_idx += 1
return mapping
# _____________________________________________________________________________
# BED
[docs]def export_bed(segments, ploidy, is_reference_male, is_sample_female,
label, show):
"""Convert a copy number array to a BED-like DataFrame.
For each region in each sample (possibly filtered according to `show`),
the columns are:
- reference sequence name
- start (0-indexed)
- end
- sample name or given label
- integer copy number
By default (show="ploidy"), skip regions where copy number is the default
ploidy, i.e. equal to 2 or the value set by --ploidy.
If show="variant", skip regions where copy number is neutral, i.e. equal to
the reference ploidy on autosomes, or half that on sex chromosomes.
"""
out = segments.data.loc[:, ["chromosome", "start", "end"]]
out["label"] = label
out["ncopies"] = (segments["cn"] if "cn" in segments
else np.rint(call.absolute_pure(segments, ploidy,
is_reference_male)))
if show == "ploidy":
# Skip regions of default ploidy
out = out[out["ncopies"] != ploidy]
elif show == "variant":
# Skip regions of non-neutral copy number
exp_copies = call.absolute_expect(segments, ploidy, is_sample_female)
out = out[out["ncopies"] != exp_copies]
return out
# _____________________________________________________________________________
# VCF
VCF_HEADER = """\
##fileformat=VCFv4.0
##fileDate={date}
##source=CNVkit v{version}
##INFO=<ID=CIEND,Number=2,Type=Integer,Description="Confidence interval around END for imprecise variants">
##INFO=<ID=CIPOS,Number=2,Type=Integer,Description="Confidence interval around POS for imprecise variants">
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
##INFO=<ID=IMPRECISE,Number=0,Type=Flag,Description="Imprecise structural variation">
##INFO=<ID=SVLEN,Number=1,Type=Integer,Description="Difference in length between REF and ALT alleles">
##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
##INFO=<ID=FOLD_CHANGE,Number=1,Type=Float,Description="Fold change">
##INFO=<ID=FOLD_CHANGE_LOG,Number=1,Type=Float,Description="Log fold change">
##INFO=<ID=PROBES,Number=1,Type=Integer,Description="Number of probes in CNV">
##ALT=<ID=DEL,Description="Deletion">
##ALT=<ID=DUP,Description="Duplication">
##ALT=<ID=CNV,Description="Copy number variable region">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype quality">
##FORMAT=<ID=CN,Number=1,Type=Integer,Description="Copy number genotype for imprecise events">
##FORMAT=<ID=CNQ,Number=1,Type=Float,Description="Copy number genotype quality for imprecise events">
""".format(date=time.strftime("%Y%m%d"), version=__version__)
# #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001
# 1 2827693 . CCGTGGATGCGGGGACCCGCATCCCCTCTCCCTTCACAGCTGAGTGACCCACATCCCCTCTCCCCTCGCA C . PASS SVTYPE=DEL;END=2827680;BKPTID=Pindel_LCS_D1099159;HOMLEN=1;HOMSEQ=C;SVLEN=-66 GT:GQ 1/1:13.9
# 2 321682 . T <DEL> 6 PASS IMPRECISE;SVTYPE=DEL;END=321887;SVLEN=-105;CIPOS=-56,20;CIEND=-10,62 GT:GQ 0/1:12
# 3 12665100 . A <DUP> 14 PASS IMPRECISE;SVTYPE=DUP;END=12686200;SVLEN=21100;CIPOS=-500,500;CIEND=-500,500 GT:GQ:CN:CNQ ./.:0:3:16.2
# 4 18665128 . T <DUP:TANDEM> 11 PASS IMPRECISE;SVTYPE=DUP;END=18665204;SVLEN=76;CIPOS=-10,10;CIEND=-10,10 GT:GQ:CN:CNQ ./.:0:5:8.3
[docs]def export_vcf(segments, ploidy, is_reference_male, is_sample_female,
sample_id=None):
"""Convert segments to Variant Call Format.
For now, only 1 sample per VCF. (Overlapping CNVs seem tricky.)
Spec: https://samtools.github.io/hts-specs/VCFv4.2.pdf
"""
vcf_columns = ["#CHROM", "POS", "ID", "REF", "ALT", "QUAL", "FILTER",
"INFO", "FORMAT", sample_id or segments.sample_id]
vcf_rows = segments2vcf(segments, ploidy, is_reference_male,
is_sample_female)
table = pd.DataFrame.from_records(vcf_rows, columns=vcf_columns)
vcf_body = table.to_csv(sep='\t', header=True, index=False,
float_format="%.3g")
return VCF_HEADER, vcf_body
[docs]def segments2vcf(segments, ploidy, is_reference_male, is_sample_female):
"""Convert copy number segments to VCF records."""
out_dframe = segments.data.loc[:, ["chromosome", "end", "log2", "probes"]]
if "cn" in segments:
out_dframe["ncopies"] = segments["cn"]
abs_expect = call.absolute_expect(segments, ploidy, is_sample_female)
else:
abs_dframe = call.absolute_dataframe(segments, ploidy, 1.0,
is_reference_male,
is_sample_female)
out_dframe["ncopies"] = np.rint(abs_dframe["absolute"])
abs_expect = abs_dframe["expect"]
idx_losses = (out_dframe["ncopies"] < abs_expect)
starts = segments.start.copy()
starts[starts == 0] = 1
out_dframe["start"] = starts
svlen = segments.end - segments.start
svlen[idx_losses] *= -1
out_dframe["svlen"] = svlen
out_dframe["svtype"] = "DUP"
out_dframe.loc[idx_losses, "svtype"] = "DEL"
out_dframe["format"] = "GT:GQ:CN:CNQ"
out_dframe.loc[idx_losses, "format"] = "GT:GQ" # :CN:CNQ ?
# Reformat this data to create INFO and genotype
# TODO be more clever about this
for out_row, abs_exp in zip(out_dframe.itertuples(index=False), abs_expect):
if (out_row.ncopies == abs_exp or
# Survive files from buggy v0.7.1 (#53)
not str(out_row.probes).isdigit()):
# Skip regions of neutral copy number
continue # or "CNV" for subclonal?
if out_row.ncopies > abs_exp:
genotype = "0/1:0:%d:%d" % (out_row.ncopies, out_row.probes)
elif out_row.ncopies < abs_exp:
# TODO XXX handle non-diploid ploidies, haploid chroms
if out_row.ncopies == 0:
# Complete deletion, 0 copies
gt = "1/1"
else:
# Single copy deletion
gt = "0/1"
genotype = "%s:%d" % (gt, out_row.probes)
info = ";".join(["IMPRECISE",
"SVTYPE=%s" % out_row.svtype,
"END=%d" % out_row.end,
"SVLEN=%d" % out_row.svlen,
"FOLD_CHANGE=%f" % 2.0 ** out_row.log2,
"FOLD_CHANGE_LOG=%f" % out_row.log2,
"PROBES=%d" % out_row.probes
# CIPOS=-56,20;CIEND=-10,62
])
yield (out_row.chromosome, out_row.start, '.', 'N',
"<%s>" % out_row.svtype, '.', '.',
info, out_row.format, genotype)
# _____________________________________________________________________________
# THetA
[docs]def export_theta(tumor_segs, normal_cn):
"""Convert tumor segments and normal .cnr or reference .cnn to THetA input.
Follows the THetA segmentation import script but avoid repeating the
pileups, since we already have the mean depth of coverage in each target
bin.
The options for average depth of coverage and read length do not matter
crucially for proper operation of THetA; increased read counts per bin
simply increase the confidence of THetA's results.
THetA2 input format is tabular, with columns:
ID, chrm, start, end, tumorCount, normalCount
where chromosome IDs ("chrm") are integers 1 through 24.
"""
# Drop any chromosomes that are not integer or XY
# THetA hard-codes X & Y, so we can, too
xy_names = (["chrX", "chrY"]
if tumor_segs.chromosome.iat[0].startswith('chr')
else ["X", "Y"])
tumor_segs = tumor_segs.autosomes(also=xy_names)
if normal_cn:
normal_cn = normal_cn.autosomes(also=xy_names)
table = tumor_segs.data.loc[:, ["start", "end"]]
# Convert chromosome names to 1-based integer indices
chr2idx = {c: i+1
for i, c in enumerate(tumor_segs.chromosome.drop_duplicates())}
table["chrm"] = tumor_segs.chromosome.replace(chr2idx)
# Unique string identifier for each row, e.g. "start_1_93709:end_1_19208166"
table["#ID"] = ["start_%d_%d:end_%d_%d"
% (row.chrm, row.start, row.chrm, row.end)
for row in table.itertuples(index=False)]
# Calculate/estimate per-segment read counts in tumor and normal samples
ref_means, nbins = ref_means_nbins(tumor_segs, normal_cn)
table["tumorCount"] = theta_read_counts(tumor_segs.log2, nbins)
table["normalCount"] = theta_read_counts(ref_means, nbins)
return table[["#ID", "chrm", "start", "end", "tumorCount", "normalCount"]]
[docs]def ref_means_nbins(tumor_segs, normal_cn):
"""Extract segments' reference mean log2 values and probe counts.
Code paths::
wt_mdn wt_old probes norm -> norm, nbins
+ * * - 0, wt_mdn
- + + - 0, wt_old * probes
- + - - 0, wt_old * size?
- - + - 0, probes
- - - - 0, size?
+ - + + norm, probes
+ - - + norm, bin counts
- + + + norm, probes
- + - + norm, bin counts
- - + + norm, probes
- - - + norm, bin counts
"""
if normal_cn:
subarrs = [subarr for _seg, subarr in normal_cn.by_ranges(tumor_segs)]
# For the normal/reference bin count, take the mean of the bin values
# within each segment so that segments match between tumor and normal.
# ENH: weighted mean, like gainloss
ref_means = np.asarray([s.log2.mean() for s in subarrs])
if "probes" in tumor_segs:
nbins = tumor_segs["probes"]
else:
nbins = np.asarray([len(s) for s in subarrs])
else:
# Assume neutral reference log2 across all segments
# (weights already account for reference log2)
ref_means = np.zeros(len(tumor_segs))
if "weight" in tumor_segs and (tumor_segs["weight"] > 1.0).any():
# Segment weights are already multiplied by probe counts
nbins = tumor_segs["weight"]
# Rescale to average 1.0 (we'll do the same below, too)
nbins /= nbins.max() / nbins.mean()
else:
if "probes" in tumor_segs:
nbins = tumor_segs["probes"]
else:
logging.warn("No probe counts in tumor segments file and no "
"normal reference given; guessing normal "
"read-counts-per-segment from segment sizes")
sizes = tumor_segs.end - tumor_segs.start
nbins = sizes / sizes.mean()
if "weight" in tumor_segs:
# Already checked -- these are old-style weights that were not
# multiplied by `probes` originally
nbins *= tumor_segs["weight"] / tumor_segs["weight"].mean()
return ref_means, nbins
[docs]def theta_read_counts(log2_ratio, nbins,
# These two scaling factors don't meaningfully affect
# THetA's calculation unless they're too small
avg_depth=500, avg_bin_width=200):
"""Calculate segments' read counts from log2-ratios.
Math:
nbases = read_length * read_count
and
nbases = bin_width * read_depth
where
read_depth = read_depth_ratio * avg_depth
So:
read_length * read_count = bin_width * read_depth
read_count = bin_width * read_depth / read_length
"""
read_depth = (2 ** log2_ratio) * avg_depth
read_count = nbins * avg_bin_width * read_depth / params.READ_LEN
return read_count.round().astype('int')
[docs]def export_theta_snps(varr):
"""Generate THetA's SNP per-allele read count "formatted.txt" files."""
# Drop any chromosomes that are not integer or XY
varr = varr.autosomes(also=(["chrX", "chrY"]
if varr.chromosome.iat[0].startswith("chr")
else ["X", "Y"]))
# Skip indels
varr = varr[(varr["ref"].str.len() == 1) & (varr["alt"].str.len() == 1)]
# Drop rows with any NaN
varr.data.dropna(subset=["depth", "n_depth", "alt_count", "n_alt_count"],
inplace=True)
# Avoid weird situation I've seen on alt contigs
varr = varr[varr["depth"] >= varr["alt_count"]]
# Reformat for THetA2
for depth_key, alt_key in (("depth", "alt_count"),
("n_depth", "n_alt_count")):
# Extract the SNP allele counts that THetA2 uses
table = varr.data.loc[:, ("chromosome", "start", depth_key, alt_key)]
table["ref_depth"] = (table[depth_key] - table[alt_key]).astype("int")
table[alt_key] = table[alt_key].astype("int")
table = table.loc[:, ("chromosome", "start", "ref_depth", alt_key)]
table.columns = ["#Chrm", "Pos", "Ref_Allele", "Mut_Allele"]
yield table
# _____________________________________________________________________________
EXPORT_FORMATS = {
'cdt': fmt_cdt,
# 'gct': fmt_gct,
'jtv': fmt_jtv,
'nexus-basic': export_nexus_basic,
'nexus-ogt': export_nexus_ogt,
'seg': export_seg,
'theta': export_theta,
'vcf': export_vcf,
}